Session 5.3 Levy
•
0 likes•4 views
The document discusses using aptamers to target cells. Aptamers are nucleic acid molecules that can bind targets with high specificity and affinity, and have advantages over antibodies like small size and easy synthesis. The author describes selecting aptamers against cell surface receptors like transferrin receptor and PSMA on cancer cells, and DEC205 on dendritic cells. This allows targeted delivery of cargo like siRNA, drugs, or antigens to specific cell types for research and clinical applications like cancer treatment and vaccines.
Report
Share
Report
Share
![Aptamers ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]](data:image/gif;base64,R0lGODlhAQABAIAAAAAAAP///yH5BAEAAAAALAAAAAABAAEAAAIBRAA7)
Recommended
Estudiantes
Real-time PCR.
Recombinant Modified Vaccine Ankara (MVA).
Construcción de plasmidos.
Selección de clones virales recombinantes por el método de formación de placa
Western blotting
electroforesis
Beta actina
KILODALTONS
Electroforesis de amplificación por PCR
wt
Su fundamento es la construcción de plásmidos a partir de fragmentos de ADN extraídos de otros plásmidos.
C Reactive protein performance (Desempeño de la PCR)
Es un método de biología molecular, en el cual una reacción enzimática in vitro amplifica millones de veces una secuencia específica de ADN durante varios ciclos repetidos en los que la secuencia blanco es copiada fielmente; para el análisis de Proteína C Reactiva con detección electroforética de productos de amplificación.
Sequencing the Human TCRβ Repertoire on the Ion S5TM
understanding of the human immune system, and thereby cancer immunology.
αβT-cells are the primary constituents of human cell-mediated adaptive immunity.
The antigen specificity of each αβT-cell is encoded in the 500-600 bp transcript
encompassing the variable portion of the rearranged TCRα and TCRβ subunits,
which can be read via NGS in a process termed repertoire sequencing. Until now,
the main challenge the field faces is the lack of a technology that can provide a
contiguous read of 600 bp to minimize the complexity of designing bias-prone
primers and informatics challenges of stitching short reads. Here we leverage the
long read capability of Ion 530™ chip to comprehensively sequence all three CDR
domains of the TCRβ chain. The Ion 530™ chip offers greater than 15 M productive
reads, allowing a multiplex of 2-4 samples with sufficient coverage for most repertoire
profiling studies. Initial testing with leukocyte total RNA demonstrates that this
multiplex PCR assay produced repertoires that were much more similar to data
derived from 5’-RACE protocol than the commonly used BIOMED-2 primer set. This
result suggested that the use of long reads minimizes bias by allowing targeting of
less variable regions. To further assess the performance of the assay, we designed a
model system of 30 plasmid controls containing common human T-cell CDR3
sequences. Each plasmid was amplified individually and sequenced to confirm the
detection of a single clonal population. Analytical sensitivity of the assay and
accuracy of the accompanied analysis solution were further evaluated by spiking in
plasmid concentrations from 10 pg to 0.0001 pg (5 million to 50 copies) in a
background of 100 ng cDNA reverse transcribed from leukocyte total RNA. Results
showed the assay offers linearity over 5 orders of magnitude of decreasing input
concentration. In summary, we have demonstrated a NGS workflow for TCRβ
sequencing that offers multiplex flexibility on Ion S5 with sample to answer in less
than 48 hours.
Enabling CNV Studies from Single Cells Using Whole Genome Amplification and L...
DNA copy number variations (CNVs) play an important role in the pathogenesis and progression of cancer. While array comparative genomic hybridization (aCGH) has generally been used to identify CNVs in the whole genome, next-generation sequencing (NGS) provides an opportunity to characterize CNVs genome-wide with unprecedented resolution, even at the single cell level.
However, CNV detection in single cells is faced with various challenges, such as incomplete genome coverage, introduction of sequence errors, GC bias and false positives.
In this new poster, we show a method for capturing the entire genomic complexity of a single cell, overcoming these challenges and ensuring accurate detection of CNVs.
Defining the relevant genome in solid tumors
Decades of cancer research including comprehensive molecular profiling combined with the
development of a broad array of targeted therapies have created the opportunity to transform
cancer care in the near future by implementing precision oncology based approaches. An
important element of this system is the widespread availability of robust and cost-effective
multivariate profiling methods in order to characterize relevant cancer associated molecular
alterations.
Current commercially available multivariate profiling methods vary dramatically with regard to
the number of cancer genes interrogated. Given that many large scale and detailed molecular
profiling studies have been completed, the landscape of somatic alterations in solid tumors is
reasonably well-known. Furthermore, the specific gene variants that are relevant to application
of targeted therapies are also a matter of record. Therefore, we set out to define the number of
relevant cancer genes for precision oncology research based on the currently available
empirical evidence.
Next-Generation Sequencing Clinical Research Milestones Infographic
DNA mutations have been implicated in several diseases, particularly cancer. NGS presents an ideal technology to efficiently profile the multitude of mutations in a high throughput manner. In 2001 the first draft of human genome was published. Since then many major milestones have been reached. Do you know when PIK3CA was identified in colon cancer? When was Olaparib for ovarian cancer treatment? This infographic traces the major clinical research milestones starting from the first draft of the human genome.
CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]
As the COVID-19 pandemic continues, people are becoming infected at an alarming rate, individuals are unknowingly spreading disease, and more lives are lost every day. There is
an immediate need for a simple, rapid, early, and sensitive point-of-care testing for COVID-
19 disease. Recently,
clustered regularly interspaced short palindromic repeats (CRISPR)-based detection methods have received substantial attention for nucleic acid-based molecular testing due to their simplicity, high sensitivity and specificity. This review explores the various CRISPR-based COVID-19 detection methods and related diagnostic devices. As with any emerging technology, CRISPR/Cas-based nucleic acid testing methods have several
challenges that must be overcome for practical applications in clinics and hospitals. More importantly, these detection methods are not limited to COVID-19 but can be applied to detect any type of pathogen, virus, and fungi that may threaten humans, agriculture, and food industries in resource-limited settings. CRISPR/Cas-based detection methods have the potential to become simpler, more reliable, more affordable, and faster in the near future, which is highly important for achieving point-of-care diagnostics.
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TM
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMThermo Fisher Scientific
T-Cell receptor (TCR) repertoire sequencing by next-generation
sequencing (NGS) is a valuable tool for building a deeper
understanding of the adaptive immune system. As immunotherapy,
particularly T-cell therapies, show increasing potential in treating
cancer, the ability to gain a detailed, unbiased view of the TCR
repertoire becomes imperative for biomarker discovery, immune
response to treatment, and study of tumor microenvironments. A key
question the field seeks to understand is the relationship between
circulating T-cells and infiltrating T-cells at the tumor site. Here, we
present a novel AmpliSeq approach for TCR repertoire sequencing
using the Ion Torrent S5 sequencer which leverages simplified
workflows and offers up to 600 bp reads which allow for a more
complete characterization of the entire V(D)J region of TCRβ. With a
unique long read length capability, this method can leverage mRNA as
input, which minimizes requirement as starting materials (10-500ng for
typical use cases) and focusing sequencing to productive TCRβ
arrangements.Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...
Meningioma’s display a broad spectrum of clinical, histological and cytogenetic features even within the same WHO grade often posing a challenge for classification and prognostic stratification. In this webinar, we will describe our experience of using targeted amplicon sequencing to develop rapid clinical sequencing system to identify and confirm the meningioma genotype in just two weeks. In addition the details of the three meningioma categories and the genes involved will be discussed.
Recommended
Estudiantes
Real-time PCR.
Recombinant Modified Vaccine Ankara (MVA).
Construcción de plasmidos.
Selección de clones virales recombinantes por el método de formación de placa
Western blotting
electroforesis
Beta actina
KILODALTONS
Electroforesis de amplificación por PCR
wt
Su fundamento es la construcción de plásmidos a partir de fragmentos de ADN extraídos de otros plásmidos.
C Reactive protein performance (Desempeño de la PCR)
Es un método de biología molecular, en el cual una reacción enzimática in vitro amplifica millones de veces una secuencia específica de ADN durante varios ciclos repetidos en los que la secuencia blanco es copiada fielmente; para el análisis de Proteína C Reactiva con detección electroforética de productos de amplificación.
Sequencing the Human TCRβ Repertoire on the Ion S5TM
understanding of the human immune system, and thereby cancer immunology.
αβT-cells are the primary constituents of human cell-mediated adaptive immunity.
The antigen specificity of each αβT-cell is encoded in the 500-600 bp transcript
encompassing the variable portion of the rearranged TCRα and TCRβ subunits,
which can be read via NGS in a process termed repertoire sequencing. Until now,
the main challenge the field faces is the lack of a technology that can provide a
contiguous read of 600 bp to minimize the complexity of designing bias-prone
primers and informatics challenges of stitching short reads. Here we leverage the
long read capability of Ion 530™ chip to comprehensively sequence all three CDR
domains of the TCRβ chain. The Ion 530™ chip offers greater than 15 M productive
reads, allowing a multiplex of 2-4 samples with sufficient coverage for most repertoire
profiling studies. Initial testing with leukocyte total RNA demonstrates that this
multiplex PCR assay produced repertoires that were much more similar to data
derived from 5’-RACE protocol than the commonly used BIOMED-2 primer set. This
result suggested that the use of long reads minimizes bias by allowing targeting of
less variable regions. To further assess the performance of the assay, we designed a
model system of 30 plasmid controls containing common human T-cell CDR3
sequences. Each plasmid was amplified individually and sequenced to confirm the
detection of a single clonal population. Analytical sensitivity of the assay and
accuracy of the accompanied analysis solution were further evaluated by spiking in
plasmid concentrations from 10 pg to 0.0001 pg (5 million to 50 copies) in a
background of 100 ng cDNA reverse transcribed from leukocyte total RNA. Results
showed the assay offers linearity over 5 orders of magnitude of decreasing input
concentration. In summary, we have demonstrated a NGS workflow for TCRβ
sequencing that offers multiplex flexibility on Ion S5 with sample to answer in less
than 48 hours.
Enabling CNV Studies from Single Cells Using Whole Genome Amplification and L...
DNA copy number variations (CNVs) play an important role in the pathogenesis and progression of cancer. While array comparative genomic hybridization (aCGH) has generally been used to identify CNVs in the whole genome, next-generation sequencing (NGS) provides an opportunity to characterize CNVs genome-wide with unprecedented resolution, even at the single cell level.
However, CNV detection in single cells is faced with various challenges, such as incomplete genome coverage, introduction of sequence errors, GC bias and false positives.
In this new poster, we show a method for capturing the entire genomic complexity of a single cell, overcoming these challenges and ensuring accurate detection of CNVs.
Defining the relevant genome in solid tumors
Decades of cancer research including comprehensive molecular profiling combined with the
development of a broad array of targeted therapies have created the opportunity to transform
cancer care in the near future by implementing precision oncology based approaches. An
important element of this system is the widespread availability of robust and cost-effective
multivariate profiling methods in order to characterize relevant cancer associated molecular
alterations.
Current commercially available multivariate profiling methods vary dramatically with regard to
the number of cancer genes interrogated. Given that many large scale and detailed molecular
profiling studies have been completed, the landscape of somatic alterations in solid tumors is
reasonably well-known. Furthermore, the specific gene variants that are relevant to application
of targeted therapies are also a matter of record. Therefore, we set out to define the number of
relevant cancer genes for precision oncology research based on the currently available
empirical evidence.
Next-Generation Sequencing Clinical Research Milestones Infographic
DNA mutations have been implicated in several diseases, particularly cancer. NGS presents an ideal technology to efficiently profile the multitude of mutations in a high throughput manner. In 2001 the first draft of human genome was published. Since then many major milestones have been reached. Do you know when PIK3CA was identified in colon cancer? When was Olaparib for ovarian cancer treatment? This infographic traces the major clinical research milestones starting from the first draft of the human genome.
CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]
As the COVID-19 pandemic continues, people are becoming infected at an alarming rate, individuals are unknowingly spreading disease, and more lives are lost every day. There is
an immediate need for a simple, rapid, early, and sensitive point-of-care testing for COVID-
19 disease. Recently,
clustered regularly interspaced short palindromic repeats (CRISPR)-based detection methods have received substantial attention for nucleic acid-based molecular testing due to their simplicity, high sensitivity and specificity. This review explores the various CRISPR-based COVID-19 detection methods and related diagnostic devices. As with any emerging technology, CRISPR/Cas-based nucleic acid testing methods have several
challenges that must be overcome for practical applications in clinics and hospitals. More importantly, these detection methods are not limited to COVID-19 but can be applied to detect any type of pathogen, virus, and fungi that may threaten humans, agriculture, and food industries in resource-limited settings. CRISPR/Cas-based detection methods have the potential to become simpler, more reliable, more affordable, and faster in the near future, which is highly important for achieving point-of-care diagnostics.
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TM
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMThermo Fisher Scientific
T-Cell receptor (TCR) repertoire sequencing by next-generation
sequencing (NGS) is a valuable tool for building a deeper
understanding of the adaptive immune system. As immunotherapy,
particularly T-cell therapies, show increasing potential in treating
cancer, the ability to gain a detailed, unbiased view of the TCR
repertoire becomes imperative for biomarker discovery, immune
response to treatment, and study of tumor microenvironments. A key
question the field seeks to understand is the relationship between
circulating T-cells and infiltrating T-cells at the tumor site. Here, we
present a novel AmpliSeq approach for TCR repertoire sequencing
using the Ion Torrent S5 sequencer which leverages simplified
workflows and offers up to 600 bp reads which allow for a more
complete characterization of the entire V(D)J region of TCRβ. With a
unique long read length capability, this method can leverage mRNA as
input, which minimizes requirement as starting materials (10-500ng for
typical use cases) and focusing sequencing to productive TCRβ
arrangements.Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...
Meningioma’s display a broad spectrum of clinical, histological and cytogenetic features even within the same WHO grade often posing a challenge for classification and prognostic stratification. In this webinar, we will describe our experience of using targeted amplicon sequencing to develop rapid clinical sequencing system to identify and confirm the meningioma genotype in just two weeks. In addition the details of the three meningioma categories and the genes involved will be discussed.
Applications of Single Cell Analysis
Single cell analysis has exploded recently mainly due to the development of high-throughput technologies such as NGS. Single cell analysis is being pursued by researchers in many areas including developmental science, cancer, biomarker discovery and more. This presentation covers some of the recent applications from developed by QIAGEN customers.
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogeneous Cellular Populations
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter region
The document describes the development of two TaqMan digital PCR liquid biopsy assays to detect mutations in the TERT promoter region associated with cancer. The assays target the C228T and C250T mutations. Testing showed the assays could reliably detect the mutations at levels as low as 0.1% mutation frequency in genomic DNA samples. Assay design was challenging due to the high GC content and repetitive sequences in the TERT promoter region. Optimization of thermal cycling conditions was needed for accurate detection of the mutations by digital PCR.
CRISPR /Cas9
CRISPR/Cas9 is a new genome editing tool that allows geneticists to precisely edit DNA sequences. It uses a bacterial immune system to cut DNA at a specific location so that parts of the genome can be removed, replaced, or added. The system involves a Cas9 enzyme guided by RNA to a targeted DNA site, where it cuts both strands of the DNA. This allows desired modifications to the genome. The summary discusses how CRISPR can be used to create genetic variability, develop disease resistance in crops, and potentially edit human organs for transplantation with less immune rejection risk. It also provides an example of using CRISPR to enhance blast resistance in rice.
Clinical molecular diagnostics for drug guidance
1. Be familiar with next generation molecular diagnostic techniques that can provide guidance in clinical decision making
2. Identify the utility of these diagnostic approaches with some examples
3. Be aware of the challenges that exist in implementing these tools as part of the routine clinical decision making process, especially in resource limited settings
Production and purification of Viral vectors for gene and cell therapy appli...
Production and purification of Viral vectors for gene and cell therapy appli...Dr. Priyabrata Pattnaik
The cell and gene therapy market is growing rapidly and is projected to reach $10 billion in 5 years. There are three main segments: gene therapy, stem cell therapy, and cell immunotherapy. Gene therapy uses viral vectors like lentivirus or adenovirus to deliver nucleic acids. The production of viral vectors like AAV involves growing HEK 293 cells in bioreactors, transfecting them with plasmids, harvesting and purifying the virus through clarification, filtration, and chromatography. CAR-T cell therapy is also discussed as an example of cell immunotherapy, which uses lentivirus to modify patient T-cells that are then reintroduced to the patient.The Clinical Genome Conference 2014
This year's 3rd Annual TCGC: The Clinical Genome Conference, held June 10-12, 2014 in San Francisco, is a three-day event that weaves together the science of sequencing and the business of implementing genomics in the clinic. It uniquely illustrates the mutual influence of those areas and the need to therefore consider the needs, challenges and opportunities of both - from next-generation sequencing and variant interpretation to insurance reimbursement and electronic health records - throughout the entire research process.Learn more at http://www.clinicalgenomeconference.com
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...Thermo Fisher Scientific
The tumor microenvironment (TME) is the intersection between tumor cells and
surrounding non-transformed cells. It contains immune cells, signaling molecules,
stromal and extracellular matrix. Research has shown the TME is often associated
with tumor growth. However, the function and regulatory mechanism of each
constituent is still poorly understood. The presence of PD-L1 is a promising marker
to predict positive response for T cell checkpoint therapy. Current IHC methods to
measure PD-L1 are subjective and highly variable. A higher-throughput and
standardized method that can systematically measure gene expression of cells
present in the TME has emerged to be a more desirable solution.
We applied the OncomineTM Immune Response Research Assay to measure the
expression of 395 genes in non-small cell lung cancer (NSCLC) research samples
from 40 matched FFPE and fresh frozen sample types. This assay covers genes
involved in checkpoint pathway, T cell regulation, cytokine and interferon signaling
pathways, and markers of different tumor infiltrating lymphocyte (TIL) subsets, as
well as tumor markers. With an input requirement of 10 ng of total RNA, libraries
were generated, templated on the Ion ChefTM and sequenced on the Ion S5TM
System. Sequencing data was analyzed and mapped with Torrent Suite Software
and differential expression analysis was conducted with AffymetrixTM Transcriptome
Analysis Console.Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and Characterization
Metagenomic Sequencing for Virus Discovery and Characterization - Dr. Ben Hause, Kansas State University, from the 2015 North American PRRS Symposium, December 4 - 5, 2015, Chicago, IL, USA.
More presentations at http://www.swinecast.com/2015-north-american-prrs-symposium
mRNA-based Therapeutics - Creative Biolabs
This slide is about the basics of mRNA-based therapy. The content includes: definition of mRNA, timeline of mRNA therapeutics, action mechanism and development strategies of mRNA drugs, therapeutic mRNA applications, and the related services provided by Creative Biolabs.
Viral Based Gene Delivery System for Car-t Cell Engineering
A brief introduction about lentiviral vector gene delivery system and its application in CAR-T cell construction. Creative Biolabs offers high quality lentivirus based CAR gene delivery service to help with your CAR-T cell development projects.
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
One potential way to acquire antibiotic resistance genes is through the food supply chain. Both livestock and feed may
acquire antibiotic resistant bacteria via different mechanisms. Foodstuffs can be exposed to antibiotic resistant bacteria
through fertilizer originating from waste-water treatment plants. This, in addition to increasing administration of antibiotics
to livestock, can lead to food being a potential source of antibiotic resistance genes. This may lead to horizontal gene
transfer to pathogenic enteropathogens and further to drug resistance in humans. Therefore, the surveillance and prevention
of antibiotic resistance genes in food is important.
To effectively combat the spread of difficult-to-treat bacterial infections, rapid surveillance methods to detect antibiotic
resistance genes are required; in order to monitor both bacterial isolates and metagenomic samples.
Since the gut is known to act as a reservoir for antibiotic resistance genes, a small-scale research study was performed on
5 stool samples isolated from healthy human adults using an antibiotic resistance gene identification PCR array. In addition,
the diversity of antibiotic resistance genes in municipal biosolids was determined using an Antibiotic Resistance Genes
Microbial DNA qPCR Array with DNA extracted from belt-filter, press-cake sewage samples.
22 antibiotic resistance genes were identified from different resistance classifications. Further studies were performed in
beef, chicken, vegetable and pork samples. In conclusion, PCR arrays can be effective tools for detection of antibiotic
resistance genes from food samples and potential fertilizer sources.
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Introducción a la tecnología de aptámeros y posibles aplicaciones terapéuticas
By Víctor M. González
Lepow Day Poster 2
1) Researchers identified differential methylation of the GRIN2D gene in colon cancer cells using reduced representation bisulfite sequencing, finding it demethylated in approximately 60% of cell lines. 2) They confirmed this epigenetic alteration led to upregulated GRIN2D expression and assessed its role in the cancer phenotype. 3) Knockdown of GRIN2D expression in demethylated RKO colon cancer cells using shRNA corresponded to reduced cell growth, suggesting GRIN2D demethylation contributes to the tumor cell phenotype. Future replication of these findings is needed to fully understand the significance.
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Advanced prostate cancer is highly heterogeneous but this inter-patient heterogeneity has until recently not been understood. We have through an international research effort dissected the molecular landscape of advanced castration resistant prostate, elucidating key molecular targets in this group of diseases. We have also shown that PARP inhibitors have antitumor activity against a significant proportion of these cancers, mainly in men whose cancers harbor DNA repair defects.
Genome Editing CRISPR-Cas9
The document discusses CRISPR-Cas9 genome editing. It begins by explaining why genome editing is useful for applications like disease modeling, gene therapy, and agriculture. It then provides details on the CRISPR-Cas9 system, describing how it uses the Cas9 enzyme guided by a short RNA to introduce targeted double-stranded breaks in DNA. The document outlines several uses of CRISPR-Cas9 in research, including generating animal models of disease and correcting genetic defects in human cells and stem cells. It also discusses approaches for screening mammalian cells using libraries of guide RNAs to induce mutations.
An NGS workflow to detect down to 0.1% allelic frequency in cfDNA
Noninvasive detection of rare mutations in blood could allow tumor monitoring for
research purposes. Research studies have suggested that cfDNA contains DNA from
tumor cells with somatic mutations that could inform on tumor progression and
therapeutic resistance. Here, we demonstrate a complete workflow from a single tube
of blood through data analysis for research samples down to a 0.1% allelic frequency.
The low abundance tumor mutations found in cfDNA requires sensitive and accurate
mutation detection. We have developed two panels that utilize an amplificationbased
assay that generates tagged DNA copies, which allows detection of low
abundance tumor mutations found in cfDNA. The two panels allow multiplex
interrogation of primary driver and resistance mutations specific to ctDNA from breast
and colon cancer. The Oncomine™ Colon cfDNA panel targets 236 hotspots within
14 genes while the Oncomine Breast cfDNA panel covers 157 hotspot mutations in
10 genes. This workflow was validated from matched single blood tubes, Streck and
K2EDTA. Additionally, the utility for cancer research was demonstrated with
concordance studies using matched FFPE and plasma from oncology samples.
miScript Single Cell Poster
Single-cell microRNA expression profiling is a challenging workflow. From cell lysis, reverse transcription, preamplificatin to real-time PCR, every step involves technical pitfalls. Therefore it is critical to have a robust system that facilitates universal cDNA synthesis and universal amplification of all miRNAs in one workflow without introducing bias. Here we present a new poster – introducing a robust real-time PCR workflow and protocol for profiling miRNA expression from a single cell and how we analyze the single cells by using the free data analysis software.
Lentiviral mediated CRISPR/Cas9
This study evaluated the effectiveness of using a lentivirus delivery system to introduce CRISPR/Cas9 genome editing in a salmonid fish cell line. The researchers optimized transfection conditions and achieved up to 60% editing efficiency at the desired RIG-I and EGFP loci. While lentivirus integration led to high editing rates, it can also result in off-target effects. The study demonstrated the potential of CRISPR/Cas9 for modeling disease resistance in fish, though more work is still needed to minimize off-target mutations.
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine Research
This document summarizes Dr. Catherine N. Kibirige's presentation on developing ultra-sensitive PCR protocols for HIV vaccine research. It discusses (1) the challenges of HIV's genetic diversity and finding conserved sequence regions for assay design, (2) how digital droplet PCR (ddPCR) was useful for quantifying cell line standards but qPCR was better for analyzing archival patient samples due to issues with ddPCR, and (3) two successful studies using the ultra-sensitive qPCR assay - a pilot study found HIV RNA more frequently in virologically suppressed patients with high inflammation, and characterization of the IAVI Viral Inhibition Assay showed HIV RNA detection within 2 days of differences in CD8 inhibition
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...Thermo Fisher Scientific
Recent studies in non-invasive biomarker research have demonstrated the potential of using cell-free nucleic acids isolated from blood plasma to serve as surrogates for solid tumors. Somatic mutations representing the tumors could be successfully detected from cell-free DNA (cfDNA) and cell-free RNA (cfRNA), providing new tumor assessment methods in addition to tissue biopsy. However, the low amount of circulating tumor fragments in the blood presents significant challenges for accurate variant detection with NGS assays. Moreover, utilization of both cfDNA and cfRNA requires methods capable of interrogating both types of analytes to maximize the utility of each blood sample.PCR, RT-PCR, FISH
Polymerase chain reaction (PCR) is a technique used to amplify specific regions of DNA. It allows scientists to make millions to billions of copies of the target DNA sequence. Real-time quantitative PCR (qPCR) allows quantification of the amount of target DNA or RNA present. In situ hybridization is a technique that uses labeled nucleic acid probes to localize specific DNA or RNA sequences within cells in preserved tissue samples.
More Related Content
What's hot
Applications of Single Cell Analysis
Single cell analysis has exploded recently mainly due to the development of high-throughput technologies such as NGS. Single cell analysis is being pursued by researchers in many areas including developmental science, cancer, biomarker discovery and more. This presentation covers some of the recent applications from developed by QIAGEN customers.
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogeneous Cellular Populations
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter region
The document describes the development of two TaqMan digital PCR liquid biopsy assays to detect mutations in the TERT promoter region associated with cancer. The assays target the C228T and C250T mutations. Testing showed the assays could reliably detect the mutations at levels as low as 0.1% mutation frequency in genomic DNA samples. Assay design was challenging due to the high GC content and repetitive sequences in the TERT promoter region. Optimization of thermal cycling conditions was needed for accurate detection of the mutations by digital PCR.
CRISPR /Cas9
CRISPR/Cas9 is a new genome editing tool that allows geneticists to precisely edit DNA sequences. It uses a bacterial immune system to cut DNA at a specific location so that parts of the genome can be removed, replaced, or added. The system involves a Cas9 enzyme guided by RNA to a targeted DNA site, where it cuts both strands of the DNA. This allows desired modifications to the genome. The summary discusses how CRISPR can be used to create genetic variability, develop disease resistance in crops, and potentially edit human organs for transplantation with less immune rejection risk. It also provides an example of using CRISPR to enhance blast resistance in rice.
Clinical molecular diagnostics for drug guidance
1. Be familiar with next generation molecular diagnostic techniques that can provide guidance in clinical decision making
2. Identify the utility of these diagnostic approaches with some examples
3. Be aware of the challenges that exist in implementing these tools as part of the routine clinical decision making process, especially in resource limited settings
Production and purification of Viral vectors for gene and cell therapy appli...
Production and purification of Viral vectors for gene and cell therapy appli...Dr. Priyabrata Pattnaik
The cell and gene therapy market is growing rapidly and is projected to reach $10 billion in 5 years. There are three main segments: gene therapy, stem cell therapy, and cell immunotherapy. Gene therapy uses viral vectors like lentivirus or adenovirus to deliver nucleic acids. The production of viral vectors like AAV involves growing HEK 293 cells in bioreactors, transfecting them with plasmids, harvesting and purifying the virus through clarification, filtration, and chromatography. CAR-T cell therapy is also discussed as an example of cell immunotherapy, which uses lentivirus to modify patient T-cells that are then reintroduced to the patient.The Clinical Genome Conference 2014
This year's 3rd Annual TCGC: The Clinical Genome Conference, held June 10-12, 2014 in San Francisco, is a three-day event that weaves together the science of sequencing and the business of implementing genomics in the clinic. It uniquely illustrates the mutual influence of those areas and the need to therefore consider the needs, challenges and opportunities of both - from next-generation sequencing and variant interpretation to insurance reimbursement and electronic health records - throughout the entire research process.Learn more at http://www.clinicalgenomeconference.com
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...Thermo Fisher Scientific
The tumor microenvironment (TME) is the intersection between tumor cells and
surrounding non-transformed cells. It contains immune cells, signaling molecules,
stromal and extracellular matrix. Research has shown the TME is often associated
with tumor growth. However, the function and regulatory mechanism of each
constituent is still poorly understood. The presence of PD-L1 is a promising marker
to predict positive response for T cell checkpoint therapy. Current IHC methods to
measure PD-L1 are subjective and highly variable. A higher-throughput and
standardized method that can systematically measure gene expression of cells
present in the TME has emerged to be a more desirable solution.
We applied the OncomineTM Immune Response Research Assay to measure the
expression of 395 genes in non-small cell lung cancer (NSCLC) research samples
from 40 matched FFPE and fresh frozen sample types. This assay covers genes
involved in checkpoint pathway, T cell regulation, cytokine and interferon signaling
pathways, and markers of different tumor infiltrating lymphocyte (TIL) subsets, as
well as tumor markers. With an input requirement of 10 ng of total RNA, libraries
were generated, templated on the Ion ChefTM and sequenced on the Ion S5TM
System. Sequencing data was analyzed and mapped with Torrent Suite Software
and differential expression analysis was conducted with AffymetrixTM Transcriptome
Analysis Console.Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and Characterization
Metagenomic Sequencing for Virus Discovery and Characterization - Dr. Ben Hause, Kansas State University, from the 2015 North American PRRS Symposium, December 4 - 5, 2015, Chicago, IL, USA.
More presentations at http://www.swinecast.com/2015-north-american-prrs-symposium
mRNA-based Therapeutics - Creative Biolabs
This slide is about the basics of mRNA-based therapy. The content includes: definition of mRNA, timeline of mRNA therapeutics, action mechanism and development strategies of mRNA drugs, therapeutic mRNA applications, and the related services provided by Creative Biolabs.
Viral Based Gene Delivery System for Car-t Cell Engineering
A brief introduction about lentiviral vector gene delivery system and its application in CAR-T cell construction. Creative Biolabs offers high quality lentivirus based CAR gene delivery service to help with your CAR-T cell development projects.
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
One potential way to acquire antibiotic resistance genes is through the food supply chain. Both livestock and feed may
acquire antibiotic resistant bacteria via different mechanisms. Foodstuffs can be exposed to antibiotic resistant bacteria
through fertilizer originating from waste-water treatment plants. This, in addition to increasing administration of antibiotics
to livestock, can lead to food being a potential source of antibiotic resistance genes. This may lead to horizontal gene
transfer to pathogenic enteropathogens and further to drug resistance in humans. Therefore, the surveillance and prevention
of antibiotic resistance genes in food is important.
To effectively combat the spread of difficult-to-treat bacterial infections, rapid surveillance methods to detect antibiotic
resistance genes are required; in order to monitor both bacterial isolates and metagenomic samples.
Since the gut is known to act as a reservoir for antibiotic resistance genes, a small-scale research study was performed on
5 stool samples isolated from healthy human adults using an antibiotic resistance gene identification PCR array. In addition,
the diversity of antibiotic resistance genes in municipal biosolids was determined using an Antibiotic Resistance Genes
Microbial DNA qPCR Array with DNA extracted from belt-filter, press-cake sewage samples.
22 antibiotic resistance genes were identified from different resistance classifications. Further studies were performed in
beef, chicken, vegetable and pork samples. In conclusion, PCR arrays can be effective tools for detection of antibiotic
resistance genes from food samples and potential fertilizer sources.
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Introducción a la tecnología de aptámeros y posibles aplicaciones terapéuticas
By Víctor M. González
Lepow Day Poster 2
1) Researchers identified differential methylation of the GRIN2D gene in colon cancer cells using reduced representation bisulfite sequencing, finding it demethylated in approximately 60% of cell lines. 2) They confirmed this epigenetic alteration led to upregulated GRIN2D expression and assessed its role in the cancer phenotype. 3) Knockdown of GRIN2D expression in demethylated RKO colon cancer cells using shRNA corresponded to reduced cell growth, suggesting GRIN2D demethylation contributes to the tumor cell phenotype. Future replication of these findings is needed to fully understand the significance.
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Advanced prostate cancer is highly heterogeneous but this inter-patient heterogeneity has until recently not been understood. We have through an international research effort dissected the molecular landscape of advanced castration resistant prostate, elucidating key molecular targets in this group of diseases. We have also shown that PARP inhibitors have antitumor activity against a significant proportion of these cancers, mainly in men whose cancers harbor DNA repair defects.
Genome Editing CRISPR-Cas9
The document discusses CRISPR-Cas9 genome editing. It begins by explaining why genome editing is useful for applications like disease modeling, gene therapy, and agriculture. It then provides details on the CRISPR-Cas9 system, describing how it uses the Cas9 enzyme guided by a short RNA to introduce targeted double-stranded breaks in DNA. The document outlines several uses of CRISPR-Cas9 in research, including generating animal models of disease and correcting genetic defects in human cells and stem cells. It also discusses approaches for screening mammalian cells using libraries of guide RNAs to induce mutations.
An NGS workflow to detect down to 0.1% allelic frequency in cfDNA
Noninvasive detection of rare mutations in blood could allow tumor monitoring for
research purposes. Research studies have suggested that cfDNA contains DNA from
tumor cells with somatic mutations that could inform on tumor progression and
therapeutic resistance. Here, we demonstrate a complete workflow from a single tube
of blood through data analysis for research samples down to a 0.1% allelic frequency.
The low abundance tumor mutations found in cfDNA requires sensitive and accurate
mutation detection. We have developed two panels that utilize an amplificationbased
assay that generates tagged DNA copies, which allows detection of low
abundance tumor mutations found in cfDNA. The two panels allow multiplex
interrogation of primary driver and resistance mutations specific to ctDNA from breast
and colon cancer. The Oncomine™ Colon cfDNA panel targets 236 hotspots within
14 genes while the Oncomine Breast cfDNA panel covers 157 hotspot mutations in
10 genes. This workflow was validated from matched single blood tubes, Streck and
K2EDTA. Additionally, the utility for cancer research was demonstrated with
concordance studies using matched FFPE and plasma from oncology samples.
miScript Single Cell Poster
Single-cell microRNA expression profiling is a challenging workflow. From cell lysis, reverse transcription, preamplificatin to real-time PCR, every step involves technical pitfalls. Therefore it is critical to have a robust system that facilitates universal cDNA synthesis and universal amplification of all miRNAs in one workflow without introducing bias. Here we present a new poster – introducing a robust real-time PCR workflow and protocol for profiling miRNA expression from a single cell and how we analyze the single cells by using the free data analysis software.
Lentiviral mediated CRISPR/Cas9
This study evaluated the effectiveness of using a lentivirus delivery system to introduce CRISPR/Cas9 genome editing in a salmonid fish cell line. The researchers optimized transfection conditions and achieved up to 60% editing efficiency at the desired RIG-I and EGFP loci. While lentivirus integration led to high editing rates, it can also result in off-target effects. The study demonstrated the potential of CRISPR/Cas9 for modeling disease resistance in fish, though more work is still needed to minimize off-target mutations.
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine Research
This document summarizes Dr. Catherine N. Kibirige's presentation on developing ultra-sensitive PCR protocols for HIV vaccine research. It discusses (1) the challenges of HIV's genetic diversity and finding conserved sequence regions for assay design, (2) how digital droplet PCR (ddPCR) was useful for quantifying cell line standards but qPCR was better for analyzing archival patient samples due to issues with ddPCR, and (3) two successful studies using the ultra-sensitive qPCR assay - a pilot study found HIV RNA more frequently in virologically suppressed patients with high inflammation, and characterization of the IAVI Viral Inhibition Assay showed HIV RNA detection within 2 days of differences in CD8 inhibition
What's hot (20)
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter region
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter region
Production and purification of Viral vectors for gene and cell therapy appli...
Production and purification of Viral vectors for gene and cell therapy appli...
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and Characterization
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and Characterization
Viral Based Gene Delivery System for Car-t Cell Engineering
Viral Based Gene Delivery System for Car-t Cell Engineering
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
An NGS workflow to detect down to 0.1% allelic frequency in cfDNA
An NGS workflow to detect down to 0.1% allelic frequency in cfDNA
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine Research
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine Research
Similar to Session 5.3 Levy
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...Thermo Fisher Scientific
Recent studies in non-invasive biomarker research have demonstrated the potential of using cell-free nucleic acids isolated from blood plasma to serve as surrogates for solid tumors. Somatic mutations representing the tumors could be successfully detected from cell-free DNA (cfDNA) and cell-free RNA (cfRNA), providing new tumor assessment methods in addition to tissue biopsy. However, the low amount of circulating tumor fragments in the blood presents significant challenges for accurate variant detection with NGS assays. Moreover, utilization of both cfDNA and cfRNA requires methods capable of interrogating both types of analytes to maximize the utility of each blood sample.PCR, RT-PCR, FISH
Polymerase chain reaction (PCR) is a technique used to amplify specific regions of DNA. It allows scientists to make millions to billions of copies of the target DNA sequence. Real-time quantitative PCR (qPCR) allows quantification of the amount of target DNA or RNA present. In situ hybridization is a technique that uses labeled nucleic acid probes to localize specific DNA or RNA sequences within cells in preserved tissue samples.
Avs molecular diagnostic techniques for detection of plant pathogens
PCR is a technique used to detect plant pathogens through amplification of DNA. It involves denaturing DNA, annealing primers, and polymerizing new strands of DNA. This process is repeated to exponentially increase the amount of target DNA. Nested PCR improves sensitivity by adding a second round of amplification. Other techniques like RT-PCR, IC-PCR, bio-PCR, and co-operational PCR have also been used to detect pathogens through nucleic acid amplification and analysis. PCR provides an efficient way to diagnose and study plant pathogens.
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...Thermo Fisher Scientific
With recent advances in next-generation sequencing (NGS) technologies, it is now possible to detect somatic mutations with allele frequencies in blood samples as low as 0.1% from circulating tumor DNA. A natural extension to this achievement is adding the ability to simultaneously detect copy number variants and gene fusions. A panel such as this addresses a full repertoire of variant classes found to be linked with certain tumors and would enable researchers additional to profile cancer samples more dynamically thus enriching current diagnostic tool sets. Here, we present progress on such an approach and apply current NGS technology to achieve our goals.targeting
A nanomedical device should perform multiple functions, so a multifunctional nanoparticle system can be constructed from the inner core outward. The core can contain a drug, while outer layers provide targeting ligands, such as antibodies, peptides, or aptamers directed against receptors overexpressed on diseased cells. Aptamers have advantages over antibodies like uniform activity between batches. Peptides can also serve as targeting ligands if they recognize receptors. Other ligands like folate or transferrin can bind their cognate receptors, but compete with circulating levels; antibodies are more specific but expensive. A variety of conjugation strategies can be used to attach targeting ligands to nanoparticles.
Chimeric Antigen Receptor (car) Technique-Creative Biolabs
This PPT is about immune system and immune therapy, some basic knowledge about Chimeric Antigen Receptor or CAR technology and its application on tumor therapy.
Epi tect methylation qpcr arrays 2013
The document describes the EpiTect Methyl II PCR Array System for analyzing DNA methylation. It provides an overview of the system which enables pathway or disease-focused profiling of regional DNA methylation using optimized kits, assays, and data analysis templates. The system offers a complete solution for DNA methylation analysis from sample isolation through data analysis. Key advantages include its ability to simultaneously analyze methylation of many genes, compatibility with standard qPCR instruments, and generation of results comparable to bisulfite sequencing but with higher throughput and without the need for bisulfite conversion.
IJAA
The document describes a study that used functional genomics to discover the molecular basis of colistin resistance in Shewanella algae MARS 14. Researchers constructed a genomic expression library of S. algae MARS 14 in E. coli and screened it to select clones resistant to colistin. Sequencing of the resistant clones identified a unique gene, ethanolamine phosphotransferase (EptA), in all clones. EptA overexpression was found to confer colistin resistance by modifying LPS and increasing 27-fold in expression in S. algae MARS 14.
Discover Therapeutic Aptamers For Vegf165 And Egfr
The document discusses discovering therapeutic aptamers for VEGF165 and EGFR through in vitro selection. Aptamers are ssDNA or RNA oligonucleotides that bind targets with high selectivity and specificity due to their well-defined tertiary structures. They have advantages over antibodies such as not requiring animals or cell culture for selection. The author aims to select aptamers for VEGF165 and EGFR to potentially use as therapeutic agents.
NEW AGE ADC IN LUNG CANCER 2022.pptx
The document discusses several antibody-drug conjugates (ADCs) that are being studied or developed for the treatment of non-small cell lung cancer (NSCLC). It summarizes clinical trial results of trastuzumab emtansine and trastuzumab deruxtecan for HER2-positive NSCLC, and sacituzumab govitecan and datopotamab deruxtecan for Trop-2 positive NSCLC. It also briefly mentions ADCs in development that target HER3, c-MET, CEACAM5, Axl, PTK7, NaPi2b, and Nectin-4 for lung cancer. The document concludes by reviewing a phase 1 clinical trial of
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...Thermo Fisher Scientific
Circulating cell free DNA is a potential tumor marker in a non-invasive blood test for the treatment and evaluation of cancer and recurrence monitoring. As circulating tumor DNA is often present at low frequencies within circulating cell free DNA, targeted sequencing on the Ion Torrent™ platform is an optimal tool or mutation detection with very little sample input required. Here, we demonstrate a complete workflow from isolation through molecular characterization of circulating tumor DNA. We have optimized a protocol using magnetic beads to isolate circulating cell free DNA. This protocol is easily automated to process up to 192 samples a day. It is also easily scalable for any input volume and can elute in volumes down to 15 μL resulting in no loss of low frequency alleles. We demonstrate comparable performance between this bead based isolation and column based isolation. We have completed molecular characterization of circulating cell free DNA using the multiplexing capabilities of AmpliSeq™ and the Ion PGM™. With the Ion AmpliSeq™ Cancer Hotspot Panel v2, we performed targeted sequencing of 50 genes of interest, covering 2800 COSMIC mutations. We demonstrate good reproducibility of amplicon representation as well as allelic frequencies. Through saturation studies and subsampling, we have determined the limit of detection of hotspots circulating cell free DNA on the Ion PGM™ to be below 1%. We further demonstrate proof of principle of this workflow on circulating cell free DNA and matched FFPE samples. Our results verify the accuracy and ease of our workflow. This protocol, from isolation through targeted sequencing, will not only result in a simple sample preparation for circulating cell free DNA but also facilitate rapid mutation detection to advance cancer research.High Sensitivity Detection of Tumor Gene Mutations-v3
This document summarizes a new method called QClamp PCR that can highly sensitively detect tumor gene mutations. QClamp uses synthetic XNA probes to selectively block amplification of wild-type DNA sequences, improving the sensitivity of PCR to detect mutations present in less than 0.1% of samples. This level of sensitivity allows detection of mutations from biopsy, tissue, or blood samples. The document discusses applications of QClamp PCR for detection of EGFR mutations in lung cancer patients and enriching samples for DNA sequencing. QClamp represents an improvement over other methods by reducing the excess of wild-type DNA that creates high background signals.
3targeting
Nanoparticles can be functionalized for biomedical applications by modifying their surface with multiple components in a defined order from the innermost to outermost. Common steps include adding a drug to the core, then a targeting ligand on the outer layer. Possible ligands include antibodies, peptides, aptamers and other molecules that bind receptors overexpressed on target cells. Aptamers have advantages over antibodies like controlled synthesis and lack of immunogenicity. Peptides identified from in vivo phage display libraries can also serve as targeting ligands. The choice of ligand depends on the drug and intended application.
Western Blotting Of Camkii Β And T 287
1. Tomato production is affected by various bacterial, fungal and viral diseases which can cause considerable yield losses.
2. One of the most devastating diseases is tomato leaf curl disease (ToLCD), caused by geminiviruses, which is increasing worldwide and poses a major constraint to tomato production in India.
3. ToLCD causes serious yield losses according to studies from the 1940s and more recently. Effective management strategies are needed to control this and other diseases threatening tomato production.
ICAAC 2013: Resumen
This document summarizes sessions from the 53rd Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) held in September 2013 in Denver, Colorado. The conference included workshops, lectures, symposia and poster sessions covering topics in infectious diseases, microbiology, antimicrobial resistance, new antibiotics, and more. One of the highlighted issues was the global rise of carbapenemase-producing organisms, with several presentations focusing on epidemiology and management of carbapenem-resistant Enterobacteriaceae. Other topics included pharmacokinetics/pharmacodynamics of antimicrobials, diagnostics using MALDI-TOF mass spectrometry, and infections such as bloodstream infections and endocarditis. Over 10,000
6. Molek tech.pptx [Repaired].pptx
Molecular diagnostic techniques involve manipulating and analyzing DNA, RNA, and proteins. These techniques are used in areas like neoplastic disorders, infectious diseases, and inherited conditions. Common techniques include amplification methods like PCR, blotting techniques such as Southern blot and Western blot, and hybridization methods like in situ hybridization and microarrays. Molecular diagnostics provides advantages like automation, speed, reliability, and sensitivity, though limitations include potential errors and sensitivity to inhibitors. These techniques have revolutionized fields like medicine, agriculture, forensics, and more by enabling abundant production of DNA and detection of genetic disorders.
Aptamers
Aptamers are single-stranded DNA or RNA molecules that can bind to specific molecular targets with high affinity and specificity. They are identified through an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX). Aptamers have various applications as diagnostic and therapeutic agents. They can serve as biosensors for pathogens by utilizing techniques like electrochemical, fluorescence, and colorimetric detection. Aptamers have been developed against viruses like influenza, HIV, hepatitis C, and others. They show potential for blocking viral fusion and inhibiting viral replication through binding to proteins and enzymes.
EACR-P0ster-17
The document summarizes a study that evaluated the expression of 11 genes in 32 surgically removed human lung cancer specimens. Ras family genes and c-myc were overexpressed in over 70% and 50% of cancerous tissues, respectively. More than 50% of adenocarcinoma cases showed moderate expression of TGF-α and HER2. Real-time RT-PCR was used to precisely quantify gene expression levels in the specimens. The results suggest that k-ras, c-myc and bcl-2 could be potential therapeutic targets for lung cancer.
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Thermo Fisher Scientific
In recent years, advances in next-generation sequencing (NGS) technologies have enabled faster and cheaper methods for uncovering the genetic basis of disease. For cancer, NGS based screening for known tumour subtypes can inform diagnosis and allow the clinician to tailor a specific therapy based on testing outcome. Here we present the validation of one such NGS based kit approved for CE-IVD* use to screen for specific chromosomal translocations in non-small cell lung cancer (NSCLC) samples by targeting specific breakpoints in known fusion transcripts.
The kit tested (Oncomine™ Solid Tumour Fusion Transcript Kit) included a single primer poolcontaining amplicon designs to simultaneously screen for over 75 specific rearrangements involving the receptor tyrosine kinase (RTK) genes ALK, RET and ROS1 as well as NTRK1. The panel was compatible with formalin-fixed paraffin-embedded (FFPE) lung tumour samples and achieved high sensitivity down to 10 ng of RNA input. In addition, amplicon assays designed at the 5’ and 3’ ends the RTK genes provide non-specific evidence that a translocation exists in a sample by comparing expression imbalance between the two ends. Validation testing was carried out at three external clinical laboratories (CLIA, CAP, INAB). In addition to positive and negative control samples, each site contributed FFPE lung tumour samples for which ALK fusion status was known prior to NGS library preparation carried out using the Ion AmpliSeq workflow. For site-specific samples (n=144, 16 samples per sequencing run), high concordance, sensitivity and specificity were measured at 97.2%, 90.5% and 98.4%, respectively.Computational Methods for detection of somatic mutations at 0.1% frequency fr...
Computational Methods for detection of somatic mutations at 0.1% frequency fr...Thermo Fisher Scientific
This document summarizes a computational method for detecting somatic mutations at 0.1% frequency from circulating cell-free DNA (cfDNA). Key points:
- The method uses a targeted sequencing panel called the Ion Lung cfDNA Assay to detect mutations in cfDNA samples, with limits of detection of 0.1% with 20ng input DNA and 0.5% with 10ng input.
- Validation studies show the method achieves ≥90% sensitivity and ≥98.3% specificity within these limits of detection.
- The full workflow called the Oncomine Liquid Biopsy Workflow analyzes samples from blood collection to variant detection in 2 days using the Ion Torrent sequencing platform.Similar to Session 5.3 Levy (20)
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
Avs molecular diagnostic techniques for detection of plant pathogens
Avs molecular diagnostic techniques for detection of plant pathogens
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
Chimeric Antigen Receptor (car) Technique-Creative Biolabs
Chimeric Antigen Receptor (car) Technique-Creative Biolabs
Discover Therapeutic Aptamers For Vegf165 And Egfr
Discover Therapeutic Aptamers For Vegf165 And Egfr
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Computational Methods for detection of somatic mutations at 0.1% frequency fr...
Computational Methods for detection of somatic mutations at 0.1% frequency fr...
More from Albert Einstein Cancer Center
Advances Agenda Slide 2016
The document discusses four topics related to developing new medical technologies and immunotherapies: 1) macrophage-tumor cell communication in tumor progression, 2) new technologies for cervical (pre)cancer screening in low- and middle-income countries, 3) designing novel immunotherapies for autoimmune diseases, and 4) development of novel immunotherapies targeting new immune checkpoints.
Nciccwithsocialmedia
This document provides a list of 69 National Cancer Institute (NCI) designated cancer centers in the United States. It includes the center name and social media presence for each, such as Twitter, Facebook, YouTube, etc. The majority of centers have a presence on Twitter (58 centers) and Facebook (57 centers). Fewer centers maintain accounts on other platforms like Flickr, Pinterest, Vine and podcasts. The document also provides totals at the bottom for each social media platform.
000 agenda
This document contains summaries of several topics related to immunobiology and cancer, including lymph formation and functions, inhibition of tumor-induced T cell anergy, generating cytolytic memory T cells, STAT3 activation in diffuse large B cell lymphoma, microbial control of intestinal innate immunity, spatiotemporal dynamics of Rho GTPases in cancer invasion, the role of macroH2A1 in cancer and senescence, epigenetic regulation of cancer by DNA methylation enzymes, targeting epigenetics in anticancer approaches, bladder cancer as a model for translational medicine, biology and treatment of prostate cancer, and personalized cancer medicine.
The Biosketch format, SciENcv and the paper
The document provides information about the new NIH biosketch format called SciENcv. It discusses how SciENcv allows researchers to create, edit, and maintain their own biosketch data. Using SciENcv, researchers can generate a biosketch that is pre-populated with information from their eRA Commons profile and automatically formatted for NIH grants. The document reviews how to set up a SciENcv profile, import publications and grants, and download a biosketch for inclusion in NIH applications. Researchers must use the new SciENcv format for all applications submitted to NIH on or after May 25, 2015.
Using MyNCBI & My Bibliography
The document provides instructions for creating and linking MyNCBI and eRA Commons accounts, adding publications to My Bibliography, linking publications to relevant grants and awards, ensuring publications comply with the NIH Public Access Policy, and assigning delegates. Key steps include registering for a MyNCBI account, linking it to an existing eRA Commons profile, searching for and adding publications to My Bibliography, associating publications with applicable grants and awards, designating publication compliance status, and allowing delegates access to view and manage accounts. The document outlines NIH requirements and guidelines for using these tools to properly track research outputs and funding sources.
Using MyNCBI & My Bibliography
The document provides instructions for using MyNCBI and MyBibliography to comply with NIH requirements. It describes how to create a MyNCBI account and link it to an eRA Commons account. It explains how to add publications to MyBibliography and link them to relevant grants/awards. It also discusses how to ensure publications are compliant with the NIH Public Access Policy and how delegates can view a PI's MyBibliography. The document is intended to help users correctly set up and utilize MyNCBI features by an October 2014 deadline.
The Biosketch format, SciENcv and the paper
The document provides guidance on using the new NIH biosketch format called SciENcv. It explains that SciENcv allows researchers to create and maintain their biosketch online by automatically populating sections from their eRA Commons profile and linked publications. The document outlines how to create a biosketch using SciENcv, including leveraging existing data, writing the required sections, and downloading the biosketch for inclusion in grant applications. Researchers must use the new biosketch format for all applications submitted to NIH on or after May 25, 2015.
Using My NCBI & My Bibliography
The document provides instructions for using MyNCBI and linking publications to grants and awards in order to comply with NIH public access policy requirements. It describes how to create a MyNCBI account and link it to an eRA Commons account. It explains how to add publications to My Bibliography and link them to relevant grants or awards. It also discusses designating a delegate and changing a publication's compliance status. The document provides resources for further information on public access policy and using MyNCBI and My Bibliography.
Nih public access_policy
The document discusses the NIH Public Access Policy, which requires that peer-reviewed articles resulting from NIH funding be made publicly available through PubMed Central. It explains what a PMCID is, who the policy applies to, and why researchers need to comply. It provides details on the different methods for getting a PMCID and setting up citation management tools like RefWorks to properly cite articles with PMCIDs or NIHMSIDs. Noncompliance could impact future NIH funding.
Guide for My Bibliography and Compliance
The document discusses the NIH public access policy, which requires researchers receiving NIH funding to submit final peer-reviewed manuscripts to PubMed Central. It outlines the policy requirements, explains the four methods of compliance, and provides tips on how to locate PMCID numbers, configure EndNote, and get help from the library to ensure compliance. Potential issues like determining the appropriate manuscript version and locating NIHMS IDs are also addressed.
Nciccwithsocialmedia
The document lists the names of various cancer centers along with their social media presence on platforms such as Twitter, Facebook, LinkedIn, YouTube, Flickr, Google+, Pinterest, blogs and websites. For each center, it indicates whether or not they have a presence on each social media platform and provides the URL for their main website. Most centers have a presence on Twitter, Facebook, and their own website, while presence on other platforms like YouTube, Flickr and Pinterest is more varied between centers.
NCICC with socialmedia
The document lists 66 cancer centers and their social media presence across several platforms. It shows that over half of the centers (58%) have a Twitter account, while slightly under half (53%) have a Facebook presence. Fewer have LinkedIn (3%), YouTube (35%), or Flickr (8%) accounts. About a third (32%) do not have any listed social media presence. Most centers link to their main website from the document.
04.2 kurland pc
1. Most cancer cells rely on aerobic glycolysis, known as the Warburg effect, which is an inefficient way to generate ATP but facilitates the production of biomass needed for cell proliferation.
2. Understanding the Warburg effect could allow researchers to stage and "fingerprint" tumors based on their metabolic profiles and capacity for invasiveness and proliferation.
3. Targeting metabolic pathways and symbiotic relationships involved in biomass production and that support proliferation, such as lactate transport between hypoxic and oxygenated tumor cells, may provide approaches for combination anti-cancer therapies using metabolic inhibitors.
03.1 libutti pc
The document outlines the vision and strategies for a new cancer care center. The center aims to provide outstanding cancer care for patients while advancing scientific understanding of cancer through translational research. It will establish a multidisciplinary, disease-based care model and develop new treatments to reduce cancer deaths and suffering. The center plans to expand clinical services and research collaborations, build a biospecimen repository, and pursue affiliations and outreach to support its growth.
02.3 gabeau mac
1. Radiation therapy has an emerging role in the multidisciplinary management of hepatocellular carcinoma (HCC) due to advances that allow higher radiation doses to be safely delivered to small liver volumes.
2. Stereotactic body radiation therapy (SBRT) shows promise for HCC but questions remain about safety, effectiveness for bridging to transplant, and downsizing lesions.
3. A pilot study is investigating the safety and feasibility of liver SBRT for HCC.
02.2 kaubisch pc
This document discusses treatment options for hepatocellular carcinoma (HCC), including both potentially curative treatments like surgery and transplantation as well as palliative treatments. It describes staging systems for HCC and the Barcelona Clinic Liver Cancer (BCLC) treatment algorithm. Promising targeted agents discussed include sorafenib, which demonstrated improved survival in phase III trials, and other multi-kinase inhibitors in phase II trials. Ongoing challenges include integrating treatment modalities and evaluating new targets as the number of potential agents increases.
02.1 kinkhabwala
This document discusses strategies for treating hepatocellular carcinoma (HCC) including:
1) Developing individualized treatment approaches using tumor biology and molecular targets.
2) Creating multimodality treatment algorithms combining locoregional therapies with molecular targets.
3) Developing novel locoregional therapies.
It describes the Montefiore Einstein Liver Center's integrated care system for liver disease and cancer, including divisions for transplantation, hepatology, and research. The center aims to standardize protocols and share resources to improve outcomes for HCC patients.
01.5 belbin aecc advances 2010 for web
This document discusses research on new epigenetic biomarkers for oropharyngeal cancer. Specifically, it finds that differential DNA methylation can predict tumor behavior and identify new therapeutic targets. A 150-CpG and 125-CpG signature was found to accurately predict aggressive disease within 24 months and nodal metastasis at diagnosis, respectively. Further validation of these predictive signatures in external patient populations could lead to a clinically useful test for treatment selection.
01.4 steidl pc for upload
The document summarizes research on targeting cancer stem cells in acute myeloid leukemia (AML). It discusses how AML stem cells (leukemia stem cells or LSCs) differ from normal stem cells in their ability to self-renew and initiate leukemia. The research aims to understand the molecular mechanisms that drive LSC function and identify transforming events involved in LSC formation and maintenance. Preclinical studies show that the transcription factor PU.1 regulates genes like JunB that are important for LSC function. The document also discusses using a small molecule drug called Eltrombopag to stimulate megakaryopoiesis in MDS/AML patients without activating LSCs, as a potential treatment for thrombocytopenia.
01.3 klampfer pc
Tumor stroma, including macrophages and other cells, actively influence cancer through soluble factors that alter signaling in tumor cells. Specifically, this document discusses:
1) Colon cancer cells stimulate macrophages to release IL-1β which mediates crosstalk between tumor cells and macrophages.
2) IL-1β inhibits TRAIL-induced apoptosis in tumor cells through NFkB and Wnt signaling pathways.
3) Vitamin D3 can inhibit IL-1β release from macrophages and restore TRAIL-induced apoptosis in a VDR-dependent manner.
More from Albert Einstein Cancer Center (20)
Recently uploaded
NVBDCP.pptx Nation vector borne disease control program
NVBDCP was launched in 2003-2004 . Vector-Borne Disease: Disease that results from an infection transmitted to humans and other animals by blood-feeding arthropods, such as mosquitoes, ticks, and fleas. Examples of vector-borne diseases include Dengue fever, West Nile Virus, Lyme disease, and malaria.
micro teaching on communication m.sc nursing.pdf
Microteaching is a unique model of practice teaching. It is a viable instrument for the. desired change in the teaching behavior or the behavior potential which, in specified types of real. classroom situations, tends to facilitate the achievement of specified types of objectives.
Physiology of Special Chemical Sensation of Taste
Title: Sense of Taste
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the structure and function of taste buds.
Describe the relationship between the taste threshold and taste index of common substances.
Explain the chemical basis and signal transduction of taste perception for each type of primary taste sensation.
Recognize different abnormalities of taste perception and their causes.
Key Topics:
Significance of Taste Sensation:
Differentiation between pleasant and harmful food
Influence on behavior
Selection of food based on metabolic needs
Receptors of Taste:
Taste buds on the tongue
Influence of sense of smell, texture of food, and pain stimulation (e.g., by pepper)
Primary and Secondary Taste Sensations:
Primary taste sensations: Sweet, Sour, Salty, Bitter, Umami
Chemical basis and signal transduction mechanisms for each taste
Taste Threshold and Index:
Taste threshold values for Sweet (sucrose), Salty (NaCl), Sour (HCl), and Bitter (Quinine)
Taste index relationship: Inversely proportional to taste threshold
Taste Blindness:
Inability to taste certain substances, particularly thiourea compounds
Example: Phenylthiocarbamide
Structure and Function of Taste Buds:
Composition: Epithelial cells, Sustentacular/Supporting cells, Taste cells, Basal cells
Features: Taste pores, Taste hairs/microvilli, and Taste nerve fibers
Location of Taste Buds:
Found in papillae of the tongue (Fungiform, Circumvallate, Foliate)
Also present on the palate, tonsillar pillars, epiglottis, and proximal esophagus
Mechanism of Taste Stimulation:
Interaction of taste substances with receptors on microvilli
Signal transduction pathways for Umami, Sweet, Bitter, Sour, and Salty tastes
Taste Sensitivity and Adaptation:
Decrease in sensitivity with age
Rapid adaptation of taste sensation
Role of Saliva in Taste:
Dissolution of tastants to reach receptors
Washing away the stimulus
Taste Preferences and Aversions:
Mechanisms behind taste preference and aversion
Influence of receptors and neural pathways
Impact of Sensory Nerve Damage:
Degeneration of taste buds if the sensory nerve fiber is cut
Abnormalities of Taste Detection:
Conditions: Ageusia, Hypogeusia, Dysgeusia (parageusia)
Causes: Nerve damage, neurological disorders, infections, poor oral hygiene, adverse drug effects, deficiencies, aging, tobacco use, altered neurotransmitter levels
Neurotransmitters and Taste Threshold:
Effects of serotonin (5-HT) and norepinephrine (NE) on taste sensitivity
Supertasters:
25% of the population with heightened sensitivity to taste, especially bitterness
Increased number of fungiform papillae
ANATOMY AND PHYSIOLOGY OF URINARY SYSTEM.pptx
Valuable Content of Human Anatomy and Physiology of Urinary system as per PCI Syllabus for Pharmacy and PharmD Students.
Journal Article Review on Rasamanikya
Rasamanikya is a excellent preparation in the field of Rasashastra, it is used in various Kushtha Roga, Shwasa, Vicharchika, Bhagandara, Vatarakta, and Phiranga Roga. In this article Preparation& Comparative analytical profile for both Formulationon i.e Rasamanikya prepared by Kushmanda swarasa & Churnodhaka Shodita Haratala. The study aims to provide insights into the comparative efficacy and analytical aspects of these formulations for enhanced therapeutic outcomes.
Efficacy of Avartana Sneha in Ayurveda
Avartana Sneha is a unique method of Preparation of Sneha Kalpana in Ayurveda, mainly it is indicated for the Vataja rogas.
Light House Retreats: Plant Medicine Retreat Europe
Our aim is to organise conscious gatherings and retreats for open and inquisitive minds and souls, with and without the assistance of sacred plants.
Ozempic: Preoperative Management of Patients on GLP-1 Receptor Agonists
Preoperative Management of Patients on GLP-1 Receptor Agonists like Ozempic and Semiglutide
ASA GUIDELINE
NYSORA Guideline
2 Case Reports of Gastric Ultrasound
#cALL# #gIRLS# In Dehradun ꧁❤8107221448❤꧂#cALL# #gIRLS# Service In Dehradun W...
#cALL# #gIRLS# In Dehradun ꧁❤8107221448❤꧂#cALL# #gIRLS# Service In Dehradun W...chandankumarsmartiso
#cALL# #gIRLS# In Dehradun ꧁❤8107221448❤꧂#cALL# #gIRLS# Service In Dehradun Women Seeking Service
Novas diretrizes da OMS para os cuidados perinatais de mais qualidade
Novas diretrizes da OMS para os cuidados perinatais de mais qualidadeProf. Marcus Renato de Carvalho
Recomendações da OMS sobre cuidados maternos e neonatais para uma experiência pós-natal positiva.
Em consonância com os ODS – Objetivos do Desenvolvimento Sustentável e a Estratégia Global para a Saúde das Mulheres, Crianças e Adolescentes, e aplicando uma abordagem baseada nos direitos humanos, os esforços de cuidados pós-natais devem expandir-se para além da cobertura e da simples sobrevivência, de modo a incluir cuidados de qualidade.
Estas diretrizes visam melhorar a qualidade dos cuidados pós-natais essenciais e de rotina prestados às mulheres e aos recém-nascidos, com o objetivo final de melhorar a saúde e o bem-estar materno e neonatal.
Uma “experiência pós-natal positiva” é um resultado importante para todas as mulheres que dão à luz e para os seus recém-nascidos, estabelecendo as bases para a melhoria da saúde e do bem-estar a curto e longo prazo. Uma experiência pós-natal positiva é definida como aquela em que as mulheres, pessoas que gestam, os recém-nascidos, os casais, os pais, os cuidadores e as famílias recebem informação consistente, garantia e apoio de profissionais de saúde motivados; e onde um sistema de saúde flexível e com recursos reconheça as necessidades das mulheres e dos bebês e respeite o seu contexto cultural.
Estas diretrizes consolidadas apresentam algumas recomendações novas e já bem fundamentadas sobre cuidados pós-natais de rotina para mulheres e neonatos que recebem cuidados no pós-parto em unidades de saúde ou na comunidade, independentemente dos recursos disponíveis.
É fornecido um conjunto abrangente de recomendações para cuidados durante o período puerperal, com ênfase nos cuidados essenciais que todas as mulheres e recém-nascidos devem receber, e com a devida atenção à qualidade dos cuidados; isto é, a entrega e a experiência do cuidado recebido. Estas diretrizes atualizam e ampliam as recomendações da OMS de 2014 sobre cuidados pós-natais da mãe e do recém-nascido e complementam as atuais diretrizes da OMS sobre a gestão de complicações pós-natais.
O estabelecimento da amamentação e o manejo das principais intercorrências é contemplada.
Recomendamos muito.
Vamos discutir essas recomendações no nosso curso de pós-graduação em Aleitamento no Instituto Ciclos.
Esta publicação só está disponível em inglês até o momento.
Prof. Marcus Renato de Carvalho
www.agostodourado.com
Best Ayurvedic medicine for Gas and Indigestion
Here is the updated list of Top Best Ayurvedic medicine for Gas and Indigestion and those are Gas-O-Go Syp for Dyspepsia | Lavizyme Syrup for Acidity | Yumzyme Hepatoprotective Capsules etc
Adhd Medication Shortage Uk - trinexpharmacy.com
The UK is currently facing a Adhd Medication Shortage Uk, which has left many patients and their families grappling with uncertainty and frustration. ADHD, or Attention Deficit Hyperactivity Disorder, is a chronic condition that requires consistent medication to manage effectively. This shortage has highlighted the critical role these medications play in the daily lives of those affected by ADHD. Contact : +1 (747) 209 – 3649 E-mail : sales@trinexpharmacy.com
Dehradun #ℂall #gIRLS Oyo Hotel 8107221448 #ℂall #gIRL in Dehradun
Dehradun #ℂall #gIRLS Oyo Hotel 8107221448 #ℂall #gIRL in Dehradun
Knee anatomy and clinical tests 2024.pdf
This includes all relevant anatomy and clinical tests compiled from standard textbooks, Campbell,netter etc..It is comprehensive and best suited for orthopaedicians and orthopaedic residents.
Role of Mukta Pishti in the Management of Hyperthyroidism
Muktapishti is a traditional Ayurvedic preparation made from Shoditha Mukta (Purified Pearl), is believed to help regulate thyroid function and reduce symptoms of hyperthyroidism due to its cooling and balancing properties. Clinical evidence on its efficacy remains limited, necessitating further research to validate its therapeutic benefits.
Recently uploaded (20)
NVBDCP.pptx Nation vector borne disease control program
NVBDCP.pptx Nation vector borne disease control program
Thyroid Gland- Gross Anatomy by Dr. Rabia Inam Gandapore.pptx
Thyroid Gland- Gross Anatomy by Dr. Rabia Inam Gandapore.pptx
Ear and its clinical correlations By Dr. Rabia Inam Gandapore.pptx
Ear and its clinical correlations By Dr. Rabia Inam Gandapore.pptx
Light House Retreats: Plant Medicine Retreat Europe
Light House Retreats: Plant Medicine Retreat Europe
Ozempic: Preoperative Management of Patients on GLP-1 Receptor Agonists
Ozempic: Preoperative Management of Patients on GLP-1 Receptor Agonists
#cALL# #gIRLS# In Dehradun ꧁❤8107221448❤꧂#cALL# #gIRLS# Service In Dehradun W...
#cALL# #gIRLS# In Dehradun ꧁❤8107221448❤꧂#cALL# #gIRLS# Service In Dehradun W...
Novas diretrizes da OMS para os cuidados perinatais de mais qualidade
Novas diretrizes da OMS para os cuidados perinatais de mais qualidade
Dehradun #ℂall #gIRLS Oyo Hotel 8107221448 #ℂall #gIRL in Dehradun
Dehradun #ℂall #gIRLS Oyo Hotel 8107221448 #ℂall #gIRL in Dehradun
Role of Mukta Pishti in the Management of Hyperthyroidism
Role of Mukta Pishti in the Management of Hyperthyroidism
Session 5.3 Levy
- 1. Levy Lab Matthew Levy Department of Biochemistry Albert Einstein College of Medicine Targeting cells with aptamers
- 4. In vitro selection of aptamers Constant regions Random region Of 40 nucleotides Library size = ~10 14-15
- 9. Anti-TfR aptamers label multiple human cancer cell lines FACs based analysis using AF488 labeled aptamer
- 10. Minimization eliminates more than half of the c2 sequence. c2 c2.min.2 c2.min.6 c2.min.9.1 38.6 kDa 14.0 kDa Brian Wengerter
- 12. Doped A9 selection GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly Heavily mutagenize (30%) Reselect (HeLa-PSMA cells)
- 13. Minimization of the anti-PSMA A9 aptamer GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly
Editor's Notes
- 20070212 combination of all data
- 20070212 combination of all data